Wuhan Ecalbio: Format Producing DNA and RNA Aptamer
Hits:1695 Date: 5/26/2023
Ecalbio company has special team in researching DNA and RNA Aptamer based on aptamer screening platform.
With a standardized producing line and a variety of analysis technologies, the platform allows rapid evaluation and identification of the specificity and affinity of known adapters for optimization and identification of adapters. Ecalbio can provide customers with customized screening services for protein targets, design the screening process that is most suitable for you, and send the sequence to the customer in a timely manner after determining the best apligator.
Aptamer is a functional nucleic acid that can recognize and bind target substances with high specificity and affinity according to Systematic Evolution of Ligands by Exponential Enrichment,is also called SELEX process. Aptamer-drug Conjugatesis widely use in medicine feild and lab analysis, including AS1411,NOX-A12, AGRO100, etc.
Aptamer development of SELEX process
AS1411 Aptamer
AS1411 is a quadruplex-forming oligonucleotide aptamer that targets nucleolin. It has anti-tumor activity. DNA, d(G-G-T-G-G-T-G-G-T-G-G-T-T-G-T-G-G-T-G-G-T-G-G-T-G-G)
Avacincaptad pegol sodium(Anti-C5 RNA Aptamer)
Avacincaptad pegol is is an anti-C5 RNA aptamer that inhibits the cleavage of complement factor 5 (C5) into C5a and C5b. Avacincaptad pegol is being used for the study of age-related macular degeneration (AMD).
Poly(oxy-1,2-ethanediyl),α-hydro-ω-methoxy-,5′-ether with RNA ((2′-deoxy-2′-fluoro)C-Gm-(2′-deoxy-2′-fluoro)C-(2′-deoxy-2′-fluoro)C-G-(2′-deoxy-2′-fluoro)C-Gm-Gm-(2′-deoxy-2′-fluoro)U-(2′-deoxy-2′-fluoro) C-(2′-deoxy-2′-fluoro)U-(2′-deoxy-2′-fluoro)C-Am-Gm-Gm-(2′-deoxy-2′-fluoro)C-G-(2′-deoxy-2′-fluoro)C-(2′-deoxy-2′-fluoro)U-Gm-Am-Gm-(2′-deoxy-2′-fluoro)U-(2′-deoxy-2′-fluoro)C-(2′-deoxy-2′-fluoro) U-Gm-Am-Gm-(2′-deoxy-2′-fluoro)U-(2′-deoxy-2′-fluoro)U-(2′-deoxy-2′-fluoro)U-A-(2′-deoxy-2′-fluoro)C-(2′-deoxy-2′-fluoro)C-(2′-deoxy-2′-fluoro)U-Gm-(2′-deoxy-2′-fluoro)C-Gm-(3′→3′)-dT) 5′-[6-[[(2,3-dihydroxypropoxy)carbonyl]amino]hexyl hydrogen phosphate], sodium salt (2:1:39)
Avacincaptad pegol sodium Chemical
Pegaptanib Sodium(RNA Aptamer)
Pegaptanib sodium is an RNA aptamer directed against vascular endothelial growth factor (VEGF)-165. Pegaptanib could be used for the study of neovascular age-related macular degeneration.
RNA,((2'-deoxy-2'-fluoro)C-Gm-Gm-A-A-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-Am-Gm-(2'-deoxy-2-fluoro)U-Gm-Am-Am-(2'-deoxy-2'-fluoro)U-Gm-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)C-Am-(2'-deoxy-2'-fluoro) U-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Gm-(3'3')-dT),5'-ester with,a'-[4,12-dioxo-6-[[[5-(phosphoonoxy)pentyl]amino]carbonyl]-3,13-dioxa-5,11-diaza-1,15-pentadecanediyl] bis [w-methoxypoly(oxy-1,2-ethanediyl)], sodium salt
Pegaptanib sodium Chemical Structure
Non-PEGylated/naked ARC186
Non-PEGylated/naked ARC186 is ARC 186 without PEG conjugation. ARC186, a aptamer, is highly potent complement inhibitors that function by blocking the convertase-catalyzed activation of C5.
Emapticap pegol
Emapticap pegol is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36).
Poly(oxy-1,2-ethanediyl), α-hydro-ω-methoxy-,5′-ether with RNA β-L-(G-C-A-C-G-U-C-C-C-U-C-A-C-C-G-G-U-G-C-A-A-G-U-G-A-A-G-C-C-G-U-G-G-C-U-C-U-G-C-G) 5′-[6-[[2-[(2-hydroxyacetyl)(2-hydroxyethyl)amino]acetyl]amino]hexyl hydrogen phosphate] (2:1)
Avacincaptad pegol Aptamer
Avacincaptad pegol, which is a pegylated aptamer, has garnered significant attention as a C5 complement inhibitor that may reduce inflammation-related retinal pigment epithelium (RPE) damage. Avacincaptad pegol caqn be used for the research of stargardt macular dystrophy (STGD1) and geographic atrophy (GA).
ADR58
ADR58 is a highly potent and selective human oncostatin M (OSM) antagonist, which can prevent the binding of OSM to the gp130 receptor and specifically antagonize OSM-mediated signaling. ADR58 can be used in the research of rheumatoid arthritis related diseases.
5'-GGGAGGACGAUGCGGAUCGCCCUGAACCGGCCCAGCAGACUGCUGACGGCACGAUCCGCAUCGUC
CUCCC-3' Egaptivon pegol Aptamer
Egaptivon pegol (ARC1779) is an aptamer, which blocks binding of the von Willebrand Factor (VWF) to platelet GPIb receptors. Egaptivon pegol has anti-thrombotic efficacy.
Poly(oxy-1,2-ethanediyl), α-hydro-ω-methoxy-, 5′-ester with RNA (Gm-Cm-Gm-Um-dG-dC-dA-Gm-Um-Gm-Cm-Cm-Um-Um-Cm-Gm-Gm-Cm-dC-Gm-sp-dT-Gm-dC-dG-dG-dT-Gm-Cm-dC-Um-dC-dC-Gm-Um-dC-Am-Cm-Gm-Cm-(3′→3′)-dT) 5′-[6-(carboxyamino)hexyl hydrogen phosphate]